multiple cloning site Search Results


90
Oligos Etc multiple cloning site oligos 5′aattaccgcggggcgcgccgtttaaacgcatgccaattgggccggccg3′ (seq id no: 18)
Multiple Cloning Site Oligos 5′Aattaccgcggggcgcgccgtttaaacgcatgccaattgggccggccg3′ (Seq Id No: 18), supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/multiple cloning site oligos 5′aattaccgcggggcgcgccgtttaaacgcatgccaattgggccggccg3′ (seq id no: 18)/product/Oligos Etc
Average 90 stars, based on 1 article reviews
multiple cloning site oligos 5′aattaccgcggggcgcgccgtttaaacgcatgccaattgggccggccg3′ (seq id no: 18) - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Promega palter-ab 3.2-kb hind iii-kpni fragment containing arsab genes cloned into the multiple cloning site of palter™21, (arsab)
Palter Ab 3.2 Kb Hind Iii Kpni Fragment Containing Arsab Genes Cloned Into The Multiple Cloning Site Of Palter™21, (Arsab), supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/palter-ab 3.2-kb hind iii-kpni fragment containing arsab genes cloned into the multiple cloning site of palter™21, (arsab)/product/Promega
Average 90 stars, based on 1 article reviews
palter-ab 3.2-kb hind iii-kpni fragment containing arsab genes cloned into the multiple cloning site of palter™21, (arsab) - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Promega multiple cloning site
Multiple Cloning Site, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/multiple cloning site/product/Promega
Average 90 stars, based on 1 article reviews
multiple cloning site - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Promega flag tag and part of the multiple cloning site
Flag Tag And Part Of The Multiple Cloning Site, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/flag tag and part of the multiple cloning site/product/Promega
Average 90 stars, based on 1 article reviews
flag tag and part of the multiple cloning site - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GenScript corporation dna fragment encoding mmbp and a multiple cloning site
Dna Fragment Encoding Mmbp And A Multiple Cloning Site, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dna fragment encoding mmbp and a multiple cloning site/product/GenScript corporation
Average 90 stars, based on 1 article reviews
dna fragment encoding mmbp and a multiple cloning site - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Oligos Etc multiple cloning site
Multiple Cloning Site, supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/multiple cloning site/product/Oligos Etc
Average 90 stars, based on 1 article reviews
multiple cloning site - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
5 PRIME multiple cloning site (mcs)
Multiple Cloning Site (Mcs), supplied by 5 PRIME, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/multiple cloning site (mcs)/product/5 PRIME
Average 90 stars, based on 1 article reviews
multiple cloning site (mcs) - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Clonexpress inc multiple cloning site (mcs) 1
Multiple Cloning Site (Mcs) 1, supplied by Clonexpress inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/multiple cloning site (mcs) 1/product/Clonexpress inc
Average 90 stars, based on 1 article reviews
multiple cloning site (mcs) 1 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Mobitec Inc portion of the multiple cloning site
Portion Of The Multiple Cloning Site, supplied by Mobitec Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/portion of the multiple cloning site/product/Mobitec Inc
Average 90 stars, based on 1 article reviews
portion of the multiple cloning site - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Twist Bioscience pucx multiple cloning site
Pucx Multiple Cloning Site, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pucx multiple cloning site/product/Twist Bioscience
Average 90 stars, based on 1 article reviews
pucx multiple cloning site - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
5 PRIME pds132 multiple cloning site
Pds132 Multiple Cloning Site, supplied by 5 PRIME, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pds132 multiple cloning site/product/5 PRIME
Average 90 stars, based on 1 article reviews
pds132 multiple cloning site - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Twist Bioscience remaining operator site p xyl/2teto together multiple-cloning site prab11
Vector for tetracycline-inducible gene expression in LAB. (A) Genetic map of pLABID-mC, derivative of the widely used and broad-host-range vector pIL252. The fragment tetR -P xyl/2tetO from the staphylococcal vector <t>pRAB11</t> was introduced to pIL252CmR. Insertion of the mCherry gene downstream of promoter P xyl/2tetO allows for direct evaluation of repression efficiency by TetR. Thick arrows represent genes, and squares represent the tetO operators, while a bent arrow indicates a promoter. Orange triangles represent AarI restriction sites, permitting the use of the vector in Golden Gate cloning. (B) Efficiency of mCherry induction from pLABID-mC in L. lactis MG1363. Expression of TetR in pLABID-mC (+ tetR ) leads to permanent repression of promoter P xyl/2tetO even in the presence of the inducer ATC. Deletion of tetR in pLABID-mC-ΔtetR (− tetR ) reverses this phenotype, reconstituting mCherry expression.
Remaining Operator Site P Xyl/2teto Together Multiple Cloning Site Prab11, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/remaining operator site p xyl/2teto together multiple-cloning site prab11/product/Twist Bioscience
Average 90 stars, based on 1 article reviews
remaining operator site p xyl/2teto together multiple-cloning site prab11 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results


Vector for tetracycline-inducible gene expression in LAB. (A) Genetic map of pLABID-mC, derivative of the widely used and broad-host-range vector pIL252. The fragment tetR -P xyl/2tetO from the staphylococcal vector pRAB11 was introduced to pIL252CmR. Insertion of the mCherry gene downstream of promoter P xyl/2tetO allows for direct evaluation of repression efficiency by TetR. Thick arrows represent genes, and squares represent the tetO operators, while a bent arrow indicates a promoter. Orange triangles represent AarI restriction sites, permitting the use of the vector in Golden Gate cloning. (B) Efficiency of mCherry induction from pLABID-mC in L. lactis MG1363. Expression of TetR in pLABID-mC (+ tetR ) leads to permanent repression of promoter P xyl/2tetO even in the presence of the inducer ATC. Deletion of tetR in pLABID-mC-ΔtetR (− tetR ) reverses this phenotype, reconstituting mCherry expression.

Journal: Microbiology Spectrum

Article Title: Development of a Tetracycline-Inducible System for Conditional Gene Expression in Lactococcus lactis and Streptococcus thermophilus

doi: 10.1128/spectrum.00668-23

Figure Lengend Snippet: Vector for tetracycline-inducible gene expression in LAB. (A) Genetic map of pLABID-mC, derivative of the widely used and broad-host-range vector pIL252. The fragment tetR -P xyl/2tetO from the staphylococcal vector pRAB11 was introduced to pIL252CmR. Insertion of the mCherry gene downstream of promoter P xyl/2tetO allows for direct evaluation of repression efficiency by TetR. Thick arrows represent genes, and squares represent the tetO operators, while a bent arrow indicates a promoter. Orange triangles represent AarI restriction sites, permitting the use of the vector in Golden Gate cloning. (B) Efficiency of mCherry induction from pLABID-mC in L. lactis MG1363. Expression of TetR in pLABID-mC (+ tetR ) leads to permanent repression of promoter P xyl/2tetO even in the presence of the inducer ATC. Deletion of tetR in pLABID-mC-ΔtetR (− tetR ) reverses this phenotype, reconstituting mCherry expression.

Article Snippet: For construction of pLABID, two synthetic DNA fragments, one containing the tetR gene under its respective promoter and part of the promoter P xyl/2tetO from pRAB11 , and the other the remaining operator site of P xyl/2tetO together with the multiple-cloning site of pRAB11, were gene synthesized (Twist Biosciences).

Techniques: Plasmid Preparation, Expressing, Clone Assay

Strains and plasmids used in this study

Journal: Microbiology Spectrum

Article Title: Development of a Tetracycline-Inducible System for Conditional Gene Expression in Lactococcus lactis and Streptococcus thermophilus

doi: 10.1128/spectrum.00668-23

Figure Lengend Snippet: Strains and plasmids used in this study

Article Snippet: For construction of pLABID, two synthetic DNA fragments, one containing the tetR gene under its respective promoter and part of the promoter P xyl/2tetO from pRAB11 , and the other the remaining operator site of P xyl/2tetO together with the multiple-cloning site of pRAB11, were gene synthesized (Twist Biosciences).

Techniques: Plasmid Preparation, Variant Assay, Expressing