|
Oligos Etc
multiple cloning site oligos 5′aattaccgcggggcgcgccgtttaaacgcatgccaattgggccggccg3′ (seq id no: 18) Multiple Cloning Site Oligos 5′Aattaccgcggggcgcgccgtttaaacgcatgccaattgggccggccg3′ (Seq Id No: 18), supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/multiple cloning site oligos 5′aattaccgcggggcgcgccgtttaaacgcatgccaattgggccggccg3′ (seq id no: 18)/product/Oligos Etc Average 90 stars, based on 1 article reviews
multiple cloning site oligos 5′aattaccgcggggcgcgccgtttaaacgcatgccaattgggccggccg3′ (seq id no: 18) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Promega
palter-ab 3.2-kb hind iii-kpni fragment containing arsab genes cloned into the multiple cloning site of palter™21, (arsab) Palter Ab 3.2 Kb Hind Iii Kpni Fragment Containing Arsab Genes Cloned Into The Multiple Cloning Site Of Palter™21, (Arsab), supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/palter-ab 3.2-kb hind iii-kpni fragment containing arsab genes cloned into the multiple cloning site of palter™21, (arsab)/product/Promega Average 90 stars, based on 1 article reviews
palter-ab 3.2-kb hind iii-kpni fragment containing arsab genes cloned into the multiple cloning site of palter™21, (arsab) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Promega
multiple cloning site Multiple Cloning Site, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/multiple cloning site/product/Promega Average 90 stars, based on 1 article reviews
multiple cloning site - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Promega
flag tag and part of the multiple cloning site Flag Tag And Part Of The Multiple Cloning Site, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/flag tag and part of the multiple cloning site/product/Promega Average 90 stars, based on 1 article reviews
flag tag and part of the multiple cloning site - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
dna fragment encoding mmbp and a multiple cloning site Dna Fragment Encoding Mmbp And A Multiple Cloning Site, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/dna fragment encoding mmbp and a multiple cloning site/product/GenScript corporation Average 90 stars, based on 1 article reviews
dna fragment encoding mmbp and a multiple cloning site - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Oligos Etc
multiple cloning site Multiple Cloning Site, supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/multiple cloning site/product/Oligos Etc Average 90 stars, based on 1 article reviews
multiple cloning site - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
5 PRIME
multiple cloning site (mcs) Multiple Cloning Site (Mcs), supplied by 5 PRIME, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/multiple cloning site (mcs)/product/5 PRIME Average 90 stars, based on 1 article reviews
multiple cloning site (mcs) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Clonexpress inc
multiple cloning site (mcs) 1 Multiple Cloning Site (Mcs) 1, supplied by Clonexpress inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/multiple cloning site (mcs) 1/product/Clonexpress inc Average 90 stars, based on 1 article reviews
multiple cloning site (mcs) 1 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Mobitec Inc
portion of the multiple cloning site Portion Of The Multiple Cloning Site, supplied by Mobitec Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/portion of the multiple cloning site/product/Mobitec Inc Average 90 stars, based on 1 article reviews
portion of the multiple cloning site - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Twist Bioscience
pucx multiple cloning site Pucx Multiple Cloning Site, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pucx multiple cloning site/product/Twist Bioscience Average 90 stars, based on 1 article reviews
pucx multiple cloning site - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
5 PRIME
pds132 multiple cloning site Pds132 Multiple Cloning Site, supplied by 5 PRIME, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pds132 multiple cloning site/product/5 PRIME Average 90 stars, based on 1 article reviews
pds132 multiple cloning site - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Twist Bioscience
remaining operator site p xyl/2teto together multiple-cloning site prab11  Remaining Operator Site P Xyl/2teto Together Multiple Cloning Site Prab11, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/remaining operator site p xyl/2teto together multiple-cloning site prab11/product/Twist Bioscience Average 90 stars, based on 1 article reviews
remaining operator site p xyl/2teto together multiple-cloning site prab11 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Microbiology Spectrum
Article Title: Development of a Tetracycline-Inducible System for Conditional Gene Expression in Lactococcus lactis and Streptococcus thermophilus
doi: 10.1128/spectrum.00668-23
Figure Lengend Snippet: Vector for tetracycline-inducible gene expression in LAB. (A) Genetic map of pLABID-mC, derivative of the widely used and broad-host-range vector pIL252. The fragment tetR -P xyl/2tetO from the staphylococcal vector pRAB11 was introduced to pIL252CmR. Insertion of the mCherry gene downstream of promoter P xyl/2tetO allows for direct evaluation of repression efficiency by TetR. Thick arrows represent genes, and squares represent the tetO operators, while a bent arrow indicates a promoter. Orange triangles represent AarI restriction sites, permitting the use of the vector in Golden Gate cloning. (B) Efficiency of mCherry induction from pLABID-mC in L. lactis MG1363. Expression of TetR in pLABID-mC (+ tetR ) leads to permanent repression of promoter P xyl/2tetO even in the presence of the inducer ATC. Deletion of tetR in pLABID-mC-ΔtetR (− tetR ) reverses this phenotype, reconstituting mCherry expression.
Article Snippet: For construction of pLABID, two synthetic DNA fragments, one containing the tetR gene under its respective promoter and part of the promoter P xyl/2tetO from pRAB11 , and the other the remaining operator site of P xyl/2tetO together with the multiple-cloning site of
Techniques: Plasmid Preparation, Expressing, Clone Assay
Journal: Microbiology Spectrum
Article Title: Development of a Tetracycline-Inducible System for Conditional Gene Expression in Lactococcus lactis and Streptococcus thermophilus
doi: 10.1128/spectrum.00668-23
Figure Lengend Snippet: Strains and plasmids used in this study
Article Snippet: For construction of pLABID, two synthetic DNA fragments, one containing the tetR gene under its respective promoter and part of the promoter P xyl/2tetO from pRAB11 , and the other the remaining operator site of P xyl/2tetO together with the multiple-cloning site of
Techniques: Plasmid Preparation, Variant Assay, Expressing